ABSTRACT
Synthetic dyes are composed of groupings of phenolic chains, such as benzene, toluene, ethyl-benzene, and xylene, considered toxic even at low concentrations. We often find these molecules in aquatic environments due to incorrect disposal of industrial effluent. These residues cause great interference in the environment because they are accumulative in the food chain. In this context, the work presented a low cost biological treatment to the red dye Drimaren X-6BN, widely used in the textile sector. The microorganism used in this study was isolated by bioprospecting soil contaminated by industrial effluent from the Americana-SP region in Brazil. The bacteria Pseudomonas aeruginosa was isolated and classified into species level by amplification of the 16S region through PCR with primers– 27F (5′ AGAGTTTGATCCTGGCTCAG 3′) and 1401R (5′CGGTGTGTACAAGACCC 3′), and examined by agarose gel electrophoresis. The microorganism was used for degradation of the dye molecule under controlled conditions. The treatment was carried out in vitro with the contaminant in a liquid medium. The tests with the contaminant showed satisfactory results on the degradation capacity of the dye by P. aeruginosa. In the 96 hours treatment period, there was a degradation of more than 80 percent. The experiments proved that P. aeruginosa has an enzymatic apparatus to degrade the dye molecule, and a decomposition model of the Drimaren X-6BN azo dye molecule is proposed. According to some studies, it is possible to predict the enzymatic mechanism used by P. aeruginosa through the azoreductase reduction pathway that breaks the azo bonds in the dye molecule. In addition, the microorganism showed resistance to the contaminant even in high concentrations of the residue. Therefore, the use of the selected P. aeruginosa microorganism has great potential for the treatment of azo dye molecules.
