ATCCGTTATTCGACTTGACAGCAG [ CAG ] nCAGCAGGCCTATTCGGCTTAGCTT

Most commercially available linkage marker panels group STRs into sets of three or four of similar length, label each marker within the group with differing fluorophores, and combine 3-4 non-overlapping sets of markers into one multiplex reaction. This allows for 12-16 markers to be run simultaneously, reducing the number of reactions per individual in a typical 10 cM genome-wide screen from approximately 380 to less than 30. When fluorescent labeling approaches are used, there are two stages at which point multiplexing can be implemented, with either the PCR performed separately for each marker, with products then pooled and analyzed simultaneously, or multiplex PCR. The former method has the advantage of eliminating the possibility of cross-marker primer interactions, and

Figure 4B.3 Short tandem repeat (STR) genotyping. Short tandem repeat element with CAG motif of variable length flanked by unique genomic sequences (in bold) can be used as polymorphic marker for familial studies (a). Amplification of this region from related DNA samples (b) with fluorophore-labeled primers complementary to the unique flanking sequences generates products of variable length that can be visualized with capillary-gel electrophoresis and a fluorimeter (c). Amplicon size is determined by comparison to size standard (not shown). Stutter bands due to in vitro slip-mispairing can be seen. Automated genotype calls confirm allelic transmission compatible with Mendelian inheritance.