ABSTRACT

This study aims to compare the Heat Tolerance Coefficient (HTC) of local and imported dairy cattle from New Zealand reared in Grati Pasuruan, and to determine the effect of the Growth Hormone Receptor (GHR) genotype on cattle's HTC. The research was conducted in Grati-Pasuruan, East Java. The research material was 31 cows (local and imported) from lactation I to II. Variables measured were respiratory frequency, rectal temperature, and HTC calculation using the equation: (Tf/Ti + Rf/Ri). Polymorphism analysis in GHR gene using PCR-RFLP (Polymerase Chain Reaction)-(Restricted Fragment Length Polymorphism) technique; PCR was performed with 386 bp amplification in the flanking region using primer F: 5′ TGCGTGCAC AGCAGCTCAACC and R: 5′ AGCAACCCCACTGCTGGGCAT and fragment digestion using restriction enzyme Alu1. Polymorphism analysis used the formula PIC (Polymorphic information content): 1 –Σp2 ij. One-way ANOVA was used to analyze the genotype effect on HTC. Polymorphism is 44.88 %. All alleles were in the Hardy-Weinberg equilibrium. Statistically, local breeds have better adaptability than imported cattle (P<0.01). All genotypes caused almost the same HTC (CC = 3.64, CD = 3.78, DD = 3.58). The conclusion is that local cattle had better adaptability than imported cattle, and the CC, CD, and DD genotypes caused the same adaptability.